Hello Nick, we recently generated some AMA1 data from P. falciparum samples using MID-tagged primers.
-
However, all these amplicons were pulled before library preparation, and we want to try a new way of generating population frequencies.
-
When generating per sample allele frequencies, we formatted the primer sheet to look like the table below. With this formatting, SeekDeep completes the analysis and reports allele frequencies for all samples.
| target |
forward |
reverse |
| PFAMA1 |
GAAATGTCCAGTATTTGGTAAAGG |
CCCATAATCCGAATTTTGCATTC |
| id |
barcode |
|
| MID01 |
ACGAGTGCGT |
|
| MID02 |
ACGCTCGACA |
|
| MID03 |
AGACGCACTC |
|
| MID04 |
AGCACTGTAG |
|
- However, since we strictly want population frequencies, we dropped the MIDs and formatted the primer sheet to look like the one below, and SeekDeep failed with the attached error.
processClusterCmds_2024-11-12_16.36_Log.json
| target |
forward |
reverse |
| PFAMA1 |
GAAATGTCCAGTATTTGGTAAAGG |
CCCATAATCCGAATTTTGCATTC |
- I figured dropping the MIDs might be causing the problem and wondered whether you've encountered this before.
Hello Nick, we recently generated some AMA1 data from P. falciparum samples using MID-tagged primers.
However, all these amplicons were pulled before library preparation, and we want to try a new way of generating population frequencies.
When generating per sample allele frequencies, we formatted the primer sheet to look like the table below. With this formatting, SeekDeep completes the analysis and reports allele frequencies for all samples.
processClusterCmds_2024-11-12_16.36_Log.json