With simple fasta file as following:
>seq1
ATATATATATATATATATATATATATATATATATAT
>seq2
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
-> pytrf findstr is working with all output format types but not with bed. I get the following error:
TypeError: 'tuple' object does not support item assignment
Version: pytrf 1.4.2
With simple fasta file as following:
-> pytrf findstr is working with all output format types but not with bed. I get the following error:
Version: pytrf 1.4.2