RNArtistCore provides:
- an easy language (a.k.a "Domain Specific Language") to describe in scripts how you would like to draw your RNA 2Ds
- a commandline tool to apply your drawing scripts on thousands of RNA 2Ds described in usual formats (CT, BPSEQ, VIENNA,....) or RNA 2Ds derived from 3Ds described in PDB format
RNArtistCore can also be used as a library. It leverages the development of graphical tools dedicated to the visualization and exploration of RNA 2Ds, like RNArtist.
The largest part of this documentation explains the syntax to write your own drawing script. But first, how to install and run RNArtistCore?
You need to have java installed on your computer and executable in a terminal. Two options to install RNArtistCore on your computer:
- either download the last release available here and unzip the zip file
- or download the source code from Github. You will need the tool maven and a Java Development Kit to be installed. In the project directory, type:
mvn clean package
Two files will be created in the target subdirectory: (i) rnartistcore-X.X.X-jar-with-dependencies.jar you can use directly as described in the examples below and (ii) a zip file packaging this jar file along with a bunch of samples and scripts to play with.
To display the help information, you need to type the following command from a terminal:
java -jar /path/to/your/rnartistcore-X.X.X-jar-with-dependencies.jar
#####################################################################
RNArtistCore: a commandline tool to create and plot RNA 2D structures
#####################################################################
Usage with a prior RNArtistCore script:
======================================
java -jar rnartistcore-X.X.X-jar-with-dependencies.jar /path/to/your/script
Usages without any prior RNArtistCore script:
============================================
Depending on the mandatory option chosen (f, d or e), you can:
* plot a single local structural file:
java -jar rnartistcore-X.X.X-jar-with-dependencies.jar [--non-mandatory-options] -f /path/to/your/structural_file
* plot several local structural files:
java -jar rnartistcore-X.X.X-jar-with-dependencies.jar [--non-mandatory-options] -d /path/to/the/root_folder/
* plot a database entry:
java -jar rnartistcore-X.X.X-jar-with-dependencies.jar [--non-mandatory-options] -e database_entry_id -o output_directory
In each case, an RNArtistCore script will be created for each structural file found. This script stores the instructions for a theme and a non-overlapping layout.
Non mandatory options can be used to change the default parameters used in the script. The script can be modified with a text editor and re-run as a prior RNArtistCore script.
Mandatory options to define the location of the structural data:
----------------------------------------------------------------
-f <arg> Compute the 2D plot for a single structural file whose path is given as argument.
An RNArtistCore script with default parameters will be created in the same folder as the structural file.
-d <arg> Compute the 2D plots from structural files stored in subfolders inside
the root folder given as argument. If some files have already been processed, they will be ignored.
At the end of the process, the root folder can be loaded with the graphical tool RNArtist to explore and manipulate the 2D plots.
-e <arg> -o <arg> Compute the 2D plot for a database entry (PDB, RNACentral and Rfam supported).
The argument for option -e has to be a valid ID for the database (like 1EHZ for PDB, RF00177 for Rfam or URS00000CFF65 for RNACentral).
An RNArtistCore script with default parameters will be created in the folder defined with the mandatory option -o.
Non mandatory options (change the default parameters in the script created):
----------------------------------------------------------------------------
--no-png The RNArtistCore script will not export its 2D plot(s) in PNG files. This option should not be used to
create a database fully compliant with the graphical tool RNArtist. RNArtist needs PNG files to preview the 2Ds.
--with-svg The RNArtistCore script will export its 2D plot(s) in SVG files
--min-color <arg> Define the first color for the gradient color. The gradient color is used to
display quantitative values in 2D plots (default: lightyellow)
--max-color <arg> Define the last color for the gradient color. The gradient color is used to
display quantitative values in 2D plots (default: firebrick)
--min-value [<arg>] Define the min value to be used to compute the gradient color between
min-color and max-color (default: 0.0)
--max-value [<arg>] Define the max value to be used to compute the gradient color between
min-color and max-color (default: 1.0)
Secondary options to process several local structural files:
-----------------------------------------------------------
--from <arg> If you're batch processing several structural files, this option allow to restart the process from the file whose name without suffix
is given as argument (if the file is named my_rna_67.vienna, then you need to type --from my_rna_67).
If some files have already been processed after this start file, they will be recomputed.
As described in the help information, you can either:
- run an RNArtistCore script. RNArtistCore will execute the instructions described in this script.
- compute a 2D from a database entry. RNArtistCore will create and run a script whose name matches the entry ID and whose location is defined with the mandatory option -o. You can then edit this script to fit your peculiarities and re-run it from the commandline.
- compute a 2D from a single local structural file. RNArtistCore will create and run a script with the same name and location as the structural file. You can then edit this script to fit your peculiarities and re-run it from the commandline.
- compute a 2Ds from several local structural files. To do this, your files has to be organized like the following:
root_folder (no structural files in the root folder)
|
|__subfolder_1
| |
| |_ file_1.vienna
| |_ file_2.vienna
|
|__subfolder_2
|
|_ file_1.vienna
|_ file_2.vienna
To produce the drawings for all the structural files, type:
java -jar /path/to/your/rnartistcore-X.X.X-jar-with-dependencies.jar -d /path/to/your/root_folder
This will generate an RNartistCore script with default parameters for each structural file (with the same name and location). One generated, each script will be evaluated to plot and save each 2D in a 250x250 PNG file. Your root folder in now a database fully compliant with the graphical tool RNArtist.
If you just want to produce your drawings with the default parameters, you can save them in 1000x1000 SVG files. To do so, you need to use the option --with-svg. If you're sure to have no need of RNArtist, you can use the options --with-svg --no-png.
You can kill the process and restart from any file using the following command:
java -jar rnartistcore-X.X.X-jar-with-dependencies.jar -d --from name_of_a_file_without_suffix /path/to/your/root_folder
For example, if you have a structure described in a file named my_rna_325B67.vienna, you can restart the process from this file by typing:
java -jar rnartistcore-X.X.X-jar-with-dependencies.jar -d --from my_rna_325B67 /path/to/your/root_folder
All the output files (scripts, images) starting from this file will be overwritten.
After a while (RNArtistCore searches for a good non-overlapping layout for each drawing), you will get the folllowing:
root_folder
|
|__subfolder_1.kts
|__subfolder_1
| |
| |_ file_1.vienna
| |_ file_1.kts
| |_ file_2.vienna
| |_ file_2.kts
|
|__subfolder_2.kts
|__subfolder_2
| |
| |_ file_1.vienna
| |_ file_1.kts
| |_ file_2.vienna
| |_ file_2.kts
|
|__drawings
|
|__subfolder_1
| |
| |_ file_1.png
| |_ file_1.svg
| |_ file_2.png
| |_ file_2.svg
|
|__subfolder_2
|
|_ file_1.png
|_ file_1.svg
|_ file_2.png
|_ file_2.svg
All SVG files are 1000x1000 and all PNG files are 250x250. You can load the SVG files in your fav editor (Inkscape, Affinity Designer, Illustrator,...).
If you have generated PNG files (meaning that you did not use the option --no-png), you can load your root folder from within RNArtist to use it as a browsable and editable database. The PNG files are then used as previews in RNArtist.
RNArtistCore can be added as a dependency into your own projects. To use RNArtistCore in your Java/Kotlin application, just add the below dependency in your file pom.xml:
<dependency>
<groupId>io.github.fjossinet.rnartist</groupId>
<artifactId>rnartistcore</artifactId>
<version>0.4.7</version>
</dependency>RNArtistCore exposes a language to write your drawing instructions more easily. All the examples described in this README are available in the file scripts/readme_plots.kts.
Please note that this is still a work under development and that all instructions are not stable. You can take a look at the changelog for details concerning the modifications.
- Important syntax rules
- The outputs of a script
- The
rnartistelement - The
svgandpngelements - The
sselement - The
themeelement - The
layoutelement - The
dataelement
Roughly, an RNArtistCore script is made with different sections:
rnartist {
svg {
//how to export the 2D in an SVG file
}
png {
//how to export the 2D in a PNG file
}
ss {
//the description of your 2D (bracket notation, parts or external file)
}
data {
//quantitative values to link to your 2D (listed here or external file)
}
theme {
//how to paint your 2D
}
layout {
//how to layout your 2D
}
}Here is a more concrete example:
rnartist {
svg {
path = "rnartist_outputs/"
}
ss {
bn {
seq = "CAACAUCAUACGUACUGCGCCCAAGCGUAACGCGAACACCACGAGUGGUGACUGGUGCUUG"
value =
"(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))"
name = "concrete_example"
}
}
theme {
details {
value = 5
}
color {
type="A"
value = "#A0ECF5"
}
color {
type="a"
value = "black"
}
color {
type="U"
value = "#9157E5"
}
color {
type="G"
value = "darkgreen"
}
color {
type="C"
value = "#E557E5"
}
}
}
}- a path has to be defined using the invariant separator "/", even if you're using Windows. For example:
rnartist {
svg {
path = "C:/Users/me/svg/"
}
ss {
vienna {
file = "C:/Users/me/vienna/test.vienna"
}
}
}- if a path doesn't start with "/" (Linux/MacOS) or "[A-Z]:/" (Windows), it is considered as a relative path (meaning that it is added to the absolute path of the rnartistcore jar file used to run the script).
- the data element has to be defined before any layout or theme element
- only a single layout, theme or data element is expected inside an rnartist element. The syntax will evolve to allow several data elements (one per dataset) with the ability to choose the dataset to be used.
- if several 2Ds are loaded at once, beside the SVG/PNG exports, RNArtistCore will also generate a copy of the running script for each 2D computed. If your input for the 2D was a file (Vienna for exemple), this script will have the same name and location. If the 2D was described inside the script (using a bracket notation for example), the file will have the same location than the rnartistcore jar and the name you gave to the 2D in the script. Each script will have the same instructions than the original one, except that it will only target a single 2D. You can then modify this script (layout, theme, output size,...) and run it without impacting the other 2Ds.
In parallel with the SVG/PNG files, a running script creates a new RNArtistCore script for each 2D processed, with the same name and location as the structural file (and with a .kts suffix).
Each script created contains the same instructions than the running script but target a single 2D. It is supplemented with the description of the non-overlapping layout computed for this 2D.
If the running script was already named and located as the structural file, it will be updated to store the description of the non-overlapping layout computed.
If the 2D was described inside the script (using a bracket notation for example), the new script will have the same location than the rnartistcore jar and the name you gave to the 2D in the running script.
The parameters available for this algorithm are:
svgorpng(mandatory): the element to define how to save the drawing in an SVG or PNG filess(mandatory): a secondary structure elementtheme: element to change the colors, details, line width,... for any object in the 2Dlayout: element to change the default layouts for the junctionsdata: element to link a dataset to the 2D
The parameters available are:
- path (mandatory): the path for the saving directory. The file will be created in this directory and its name will correspond to the name of the input file or the name of the molecule if the 2D was not described in a local file (see below).
rnartist {
svg {
path = "media/"
}
ss {
bn {
value = "((((....))))"
}
}
}You have different ways to define a secondary structure:
- by describing all the structural elements yourself using the element
parts - from a bracket notation using the element
bn - from a file using the elements
vienna,bpseq,ct, orstockholm - from a public database using the elements
rfam,rnacentral, orpdb
Inside an element parts, you need to describe your 2D with the elements rna and helix
The element rna needs at least an attribute seq or an attribute length:
- seq (mandatory in no length): the sequence of your molecule. If this parameter is not defined, a random sequence is computed. Each execution of the script will compute a different sequence.
- length (mandatory if no seq): the length of your molecule. If this parameter is defined, a random sequence is computed. Each execution of the script will compute a different sequence.
- name: the name of the molecule (default:
A)
The helix element needs at least a location:
- name: the name of the helix
- location (mandatory): the location of the helix
The parameter location needs to have the following format:
location {
1 to 10
30 to 40
}In this example, the location is made with absolute positions from 1 to 10 and 30 to 40 (inclusive). An object 2D is targeted if its own location is inside the one defined with this parameter.
rnartist {
png {
path = "media/"
}
ss {
parts {
rna {
seq = "ACAUAGCGUUCGCGCGUGUUCCUGUAGUUAAACUUAGAGUAUCUGUACUUAGAAUUAAUGUUGGAGGCCCAACAAUGGGUGUGGAUCAAUCGUAGUUAUUU"
name = "rna_and_helix_elements"
}
helix {
name = "H1"
location {
1 to 3
17 to 19
}
}
helix {
name = "H2"
location {
6 to 8
13 to 15
}
}
helix {
name = "H3"
location {
23 to 25
39 to 41
}
}
helix {
name = "H4"
location {
28 to 30
35 to 37
}
}
helix {
name = "H5"
location {
45 to 47
80 to 82
}
}
helix {
name = "H6"
location {
48 to 50
64 to 66
}
}
helix {
name = "H7"
location {
53 to 55
60 to 62
}
}
helix {
name = "H8"
location {
69 to 71
76 to 78
}
}
helix {
name = "H9"
location {
83 to 85
99 to 101
}
}
helix {
name = "H10"
location {
88 to 90
95 to 97
}
}
}
}
theme {
details {
value = 1
}
}
}The parameters available are:
- value (mandatory): the secondary structure described with the dot-bracket notation
- name: the name of the molecule (default:
A) - seq: the sequence of your molecule. If this parameter is not defined, a random sequence is computed. Each execution of the script will compute a different sequence.
rnartist {
svg {
path = "media/"
}
ss {
bn {
value = "((((....))))"
}
}
}rnartist {
svg {
path = "media/"
}
ss {
bn {
value = "((((....))))"
name = "My Fav RNA"
}
}
}rnartist {
svg {
path = "media/"
}
ss {
bn {
value = "((((....))))"
seq = "GGGGAAAACCCC"
name = "My Fav RNA"
}
}
}The secondary structure will be constructed from the data stored in the file.
The parameters are:
- file or path (mandatory): the file property defines the absolute path of a single input file. The path property defines the absolute path of a folder containing input files.
- name: if the file contains several rnas, this parameter allows to precise the one you want to use. If no name is provided, all rnas will be processed. Concerning the Stockholm format, you can use the name "consensus" to plot the consensus structure.
rnartist {
png {
path = "media/"
}
ss {
bpseq {
file = "myrna.bpseq"
}
}
}rnartist {
png {
path = "media/"
}
ss {
vienna {
path = "/Users/bwayne/project_1/my_vienna_files/"
}
}
}rnartist {
png {
path = "media/"
}
ss {
pdb {
file = "myrna.pdb"
name = "A"
}
}
}rnartist {
png {
path = "media/"
}
ss {
stockholm {
file = "./my_files/RF00072.stk"
name = "consensus"
}
}
}rnartist {
png {
path = "media/"
}
ss {
stockholm {
file = "C:/project/RF00072.stk"
name = "AJ009730.1/1-133"
}
}
}The secondary structure will be constructed from the data stored in a database entry.
The parameters are:
id(mandatory): the id of your database entryname: if the entry contains several rnas, this parameter allows to precise the one you want to use. If no name is provided, all the rnas will be processed. Concerning Rfam, you can use the name "consensus" to plot the consensus structure.
ss {
rfam {
id = "RF00072"
name = "AJ009730.1/1-133"
}
}ss {
rfam {
id = "RF00072"
name = "consensus"
}
}ss {
pdb {
id = "1EHZ"
}
}ss {
pdb {
id = "1JJ2"
name = "0"
}
}ss {
rnacentral {
id = "URS00000CFF65"
}
}The element rfam can contain an attribute named use alignment numbering. If this attribute is set, the locations described in the script will be understood as locations in the original alignment.
ss {
rfam {
id = "RF00072"
name = "consensus"
use alignment numbering
}
}Using this element, you choose the rendering level for any object in the 2D drawing, from single residues to entire structural domains. Each object can be lowly or highly rendered. In general, an object 2D produces a simple shape when it is lowly rendered and it doesn't allow its children to be rendered.
| Object 2D | Referenced as | parent | children | lowly rendered | highly rendered |
|---|---|---|---|---|---|
| Helix | helix | 2D | Secondary Interaction Phosphodiester Bond |
single line | children rendering |
| Junction | junction | 2D | Residue Shape Phosphodiester Bond |
circle | children rendering |
| Single Strand | single_strand | 2D | Residue Shape Phosphodiester Bond |
single line | children rendering |
| Secondary Interaction | secondary_interaction | Helix | Residue Shape Interaction Symbol |
children rendering | |
| Tertiary Interaction | tertiary_interaction | 2D | Interaction Symbol | single line | children rendering |
| Phosphodiester Bond | phosphodiester_bond | Helix Junction Single Strand |
single line | single line | |
| Residue Shape | N, X, A, U, G, C, R or Y | Secondary Interaction Junction Single Strand |
Residue Character | shape (circle) + children rendering | |
| Residue Character | n, x, a, u, g, c, r or y | Residue Shape | character | ||
| Interaction Symbol | interaction_symbol | Secondary Interaction Tertiary Interaction |
single line | symbol (triangle, circle, square, double lines,...) |
Concerning junctions, you can be more specific:
| Object 2D | Referenced as |
|---|---|
| Apical Loops | apical_loop |
| Inner Loops | inner_loop |
| 3-Way Junctions | 3_way |
| 4-Way Junctions | 4_way |
Concerning objects 2D that can have different types of parent (Phosphodiester Bond, Residue Shape), the character @ allows you to be more specific:
| Object 2D | Referenced as |
|---|---|
| Phosphodiester Bond in Helices | phosphodiester_bond@helix |
| Adenine Shapes in Junctions | A@junction |
| Purine Characters in Inner loops | r@inner_loop |
| and so on.... |
A theme element can contains a single details element (to quickly render the entire 2D) and one or several color, line, show and/or hide elements:
color: defines the color for objects 2Dshow: highly render objects 2Dhide: lowly render objects 2Dline: set the line width for objects 2D
The order of the elements color, show, hide and line is taken into account inside the element theme.
The scheme element allows to map a color scheme on the full 2D. It can be:
- Persian Carolina
- Snow Lavender
- Fuzzy French
- Chestnut Navajo
- Irresistible Turquoise
- Charm Jungle
- Atomic Xanadu
- Pale Coral
- Maximum Salmon
- Pacific Dream
- New York Camel
- Screamin' Olive
- Baby Lilac
- Celeste Olivine
- Midnight Paradise
- African Lavender
- Charcoal Lazuli
- Pumpkin Vegas
To quickly change the rendering level of an entire 2D, you can use the element named details. Five details levels are available:
| Details level | Helix | Junction | Single Strand | Phosphodiester Bond | Secondary Interaction | Residue Shape | Residue Character | Interaction Symbol |
|---|---|---|---|---|---|---|---|---|
| 1 | Low | Low | Low | Low | Low | Low | Low | Low |
| 2 | High | High | High | High | High | Low | Low | Low |
| 3 | High | High | High | High | High | High | Low | Low |
| 4 | High | High | High | High | High | High | High | Low |
| 5 | High | High | High | High | High | High | High | High |
Level 1
rnartist {
png {
path = "media/"
}
ss {
bn {
value =
"(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))"
name = "details_lvl1"
}
}
theme {
details {
value = 1
}
color {
type = "helix"
value = "red"
}
color {
type = "junction"
value = "green"
}
}
}Level 2
rnartist {
png {
path = "media/"
}
ss {
bn {
value =
"(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))"
name = "details_lvl2"
}
}
theme {
details {
value = 2
}
color {
type = "helix"
value = "red"
}
color {
type = "junction"
value = "green"
}
}
}Level 3
rnartist {
png {
path = "media/"
}
ss {
bn {
value =
"(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))"
name = "details_lvl3"
}
}
theme {
details {
value = 3
}
scheme {
value = "Pumpkin Vegas"
}
}
}Level 4
rnartist {
png {
path = "media/"
}
ss {
bn {
value =
"(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))"
name = "details_lvl4"
}
}
theme {
details {
value = 4
}
scheme {
value = "Pumpkin Vegas"
}
}
}Level 5
rnartist {
png {
path = "media/"
}
ss {
bn {
value =
"(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))"
name = "details_lvl5"
}
}
theme {
details {
value = 5
}
scheme {
value = "Pumpkin Vegas"
}
}
}Parameters:
value: an HTML color code or predefined color names. If the parametertois defined, this parameter defines the first color for the gradient.to: the last color in a gradient (HTML color code or predefined color names)type: the type of objects 2D targeted (check this table for details)location: the location of objects 2D targeteddata: selection based on the values linked to the residues (see explanation for this element below)
If the parameter type is not defined, all types are targeted. You can define several types in the same string using a space as separator: "single_strand R C interaction_symbol"
The parameter location needs to have the following format:
location {
1 to 10
30 to 40
}In this example, the location is made with absolute positions from 1 to 10 and 30 to 40 (inclusive). An object 2D is targeted if its own location is inside the one defined with this parameter.
rnartist {
png {
path = "media/"
}
ss {
bn {
seq = "CAGAUAAGAAGGUUCCCCGAUAUGUUGGGCAACCAAAGAAUUCAUGUUCUUCCUUUGUUUG"
value =
"(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))"
name = "nice_colors"
}
}
theme {
details {
value = 5
}
color {
type = "Y"
value = "lavenderblush"
}
color {
type = "y"
value = "black"
}
color {
type = "R"
value = "red"
}
color {
type = "r"
value = "white"
}
color {
type = "G g"
value = "#ed781f"
location {
5 to 20
}
}
}
}This element allows to highly render a 2D object.
Parameters:
type: the type of objects 2D targeted (check this table for details)location: the location of 2D objects targeteddata: selection based on the values linked to the residues (see explanation for this element below)
An empty show element will do nothing.
If the parameter type is not defined, all types are targeted. You can define several types in the same string using a space as separator: "single_strand R C interaction_symbol"
The parameter location needs to have the following format:
location {
1 to 10
30 to 40
}In this example, the location is made with absolute positions from 1 to 10 and 30 to 40 (inclusive). A 2D object is targeted if its own location is inside the one defined with this parameter.
The hide element does the opposite of the show element.
Parameters:
type: the type of objects 2D targeted (check this table for details)location: the location of objects 2D targeteddata: selection based on the values linked to the residues (see explanation for this element below)
An empty hide element will do nothing.
If the parameter type is not defined, all types are targeted. You can define several types in the same string using a space as separator: "single_strand R C interaction_symbol"
The parameter location needs to have the following format:
location {
1 to 10
30 to 40
}In this example, the location is made with absolute positions from 1 to 10 and 30 to 40 (inclusive). A 2D object is targeted if its own location is inside the one defined with this parameter.
Depending of the value of the details element, you will need to use elements show or hide to get the result you want. In the following examples, we start with the details level 5 for the full 2D and we hide less and less children elements of a single helix defined by its location.
rnartist {
png {
path = "media/"
}
ss {
bn {
seq = "CUUACUCGAGUGACCUUGCUUG"
value = "..((..((((....))))..))"
name = "helix_lvl0"
}
}
theme {
details {
value = 5
}
scheme {
value = "Celeste Olivine"
}
hide {
type = "helix"
location {
7 to 10
15 to 18
}
}
}
}rnartist {
png {
path = "media/"
}
ss {
bn {
seq = "CUUACUCGAGUGACCUUGCUUG"
value = "..((..((((....))))..))"
name = "helix_lvl1"
}
}
theme {
details {
value = 5
}
scheme {
value = "Celeste Olivine"
}
hide {
type = "secondary_interaction"
location {
7 to 10
15 to 18
}
}
}
}rnartist {
png {
path = "media/"
}
ss {
bn {
seq = "CUUACUCGAGUGACCUUGCUUG"
value = "..((..((((....))))..))"
name = "helix_lvl2"
}
}
theme {
details {
value = 5
}
scheme {
value = "Celeste Olivine"
}
hide {
type = "N interaction_symbol"
location {
7 to 10
15 to 18
}
}
}
}rnartist {
png {
path = "media/"
}
ss {
bn {
seq = "CUUACUCGAGUGACCUUGCUUG"
value = "..((..((((....))))..))"
name = "helix_lvl3"
}
}
theme {
details {
value = 5
}
scheme {
value = "Celeste Olivine"
}
hide {
type = "n interaction_symbol"
location {
7 to 10
15 to 18
}
}
}
}rnartist {
png {
path = "media/"
}
ss {
bn {
seq = "CUUACUCGAGUGACCUUGCUUG"
value = "..((..((((....))))..))"
name = "helix_lvl4"
}
}
theme {
details {
value = 5
}
scheme {
value = "Celeste Olivine"
}
hide {
type = "interaction_symbol"
location {
7 to 10
15 to 18
}
}
}
}rnartist {
png {
path = "media/"
}
ss {
bn {
seq = "CUUACUCGAGUGACCUUGCUUG"
value = "..((..((((....))))..))"
name = "helix_lvl5"
}
}
theme {
details {
value = 5
}
scheme {
value = "Celeste Olivine"
}
}
}Now we set the 2D at details level 2 and we add new elements to be draw with show elements:
rnartist {
png {
path = "media/"
}
ss {
bn {
seq = "CUUACUCGAGUGACCUUGCUUG"
value = "..((..((((....))))..))"
name = "helix_hidden_parts"
}
}
theme {
details {
value = 2
}
scheme {
value = "African Lavender"
}
show {
type = "helix phosphodiester_bond secondary_interaction"
location {
7 to 8
10 to 10
15 to 15
17 to 18
}
}
show {
type = "N"
location {
7 to 8
17 to 18
}
}
}
}Parameters:
value: the line widthtype: the type of objects 2D targeted (check this table for details)location: the location of objects 2D targeted
If the parameter type is not defined, all types are targeted. You can define several types in the same string using a space as separator: "single_strand R C interaction_symbol"
The parameter location needs to have the following format:
location {
1 to 10
30 to 40
}In this example, the location is made with absolute positions from 1 to 10 and 30 to 40 (inclusive). A 2D object is targeted if its own location is inside the one defined with this parameter.
The rnartist drawing algorithm computes the layout to avoid overlapping of objects 2D. One of the parameter used is the default orientation of the helices linked to each type of junction (inner loops, 3-way junctions,...). Each junction is linked to an "in" helix (the red arrow in the diagram below) and to "out" helices (black arrows). The orientation for each "out" helix is defined according to the directions of a compass, the "in" helix making the south direction.
You can change the default layout for each type of junction by adding one or several junction elements to the layout. A junction element contains the following parameters:
type: the type of the junction (1 for apical loops, 2 for inner loops, 3 for 3-way junctions,...)location: the location of objects 2D targetedout_ids: the compass directions for the leaving helices
If the parameter type is set, all the junctions for this type are targeted. The new layout will be used before the non-overlapping 2D plot.
If the parameter location is set, the layout will be applied after the non-overlapping plot. For the junction targeted, the drawing engine will not take care of overlapping elements anymore.
In the following examples, you can see the different results when we modify the layout for all the 3-way junctions.
rnartist {
png {
path = "media/"
}
ss {
bn {
value = "(((..(((..(((..(((((....))))).(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).)))..(((((....)))))..)))...)))...(((..(((.(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))...(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).(((((....)))))..)))...)))"
name = "3way_0"
}
}
theme {
details {
value = 1
}
}
}rnartist {
png {
path = "media/"
}
ss {
bn {
value = "(((..(((..(((..(((((....))))).(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).)))..(((((....)))))..)))...)))...(((..(((.(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))...(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).(((((....)))))..)))...)))"
name = "3way_1"
}
}
theme {
details {
value = 1
}
}
layout {
junction {
type = 3
out_ids ="nnw nne"
}
}
}rnartist {
png {
path = "media/"
}
ss {
bn {
value = "(((..(((..(((..(((((....))))).(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).)))..(((((....)))))..)))...)))...(((..(((.(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))...(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).(((((....)))))..)))...)))"
name = "3way_2"
}
}
theme {
details {
value = 1
}
}
layout {
junction {
type = 3
out_ids ="nw ne"
}
}
}rnartist {
png {
path = "media/"
}
ss {
bn {
value = "(((..(((..(((..(((((....))))).(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).)))..(((((....)))))..)))...)))...(((..(((.(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))...(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).(((((....)))))..)))...)))"
name = "3way_3"
}
}
theme {
details {
value = 1
}
}
layout {
junction {
type = 3
out_ids ="wnw ene"
}
}
}rnartist {
png {
path = "media/"
}
ss {
bn {
value = "(((..(((..(((..(((((....))))).(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).)))..(((((....)))))..)))...)))...(((..(((.(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))...(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).(((((....)))))..)))...)))"
name = "3way_4"
}
}
theme {
details {
value = 1
}
}
layout {
junction {
type = 3
out_ids ="w e"
}
}
}rnartist {
png {
path = "media/"
}
ss {
bn {
value = "(((..(((..(((..(((((....))))).(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).)))..(((((....)))))..)))...)))...(((..(((.(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))...(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).(((((....)))))..)))...)))"
name = "3way_5"
}
}
theme {
details {
value = 1
}
}
layout {
junction {
type = 3
out_ids ="w n"
}
}
}rnartist {
png {
path = "media/"
}
ss {
bn {
value = "(((..(((..(((..(((((....))))).(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).)))..(((((....)))))..)))...)))...(((..(((.(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))...(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).(((((....)))))..)))...)))"
name = "3way_6"
}
}
theme {
details {
value = 1
}
}
layout {
junction {
type = 3
out_ids ="n e"
}
}
}And now with full details:
rnartist {
png {
path = "media/"
}
ss {
bn {
value = "(((..(((..(((..(((((....))))).(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).)))..(((((....)))))..)))...)))...(((..(((.(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))...(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).(((((....)))))..)))...)))"
name = "3way_full_details"
}
}
theme {
details {
value = 3
}
scheme {
value = "Atomic Xanadu"
}
}
layout {
junction {
type = 3
out_ids ="wnw n"
}
}
}With the last example, you can see that everything is fine except for the 3-way junction on the right-most side. We're adding a specific layout for this junction to get a better plot
rnartist {
png {
path = "media/"
}
ss {
bn {
value = "(((..(((..(((..(((((....))))).(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).)))..(((((....)))))..)))...)))...(((..(((.(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))...(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...))).(((((....)))))..)))...)))"
name = "3way_full_details_fixed"
}
}
theme {
details {
value = 3
}
scheme {
value = "Atomic Xanadu"
}
}
layout {
junction {
type = 3
out_ids = "wnw n"
}
junction {
location {
206 to 209
232 to 235
248 to 251
}
out_ids = "n e"
}
}
}Datasets can be linked to an RNA secondary structure. You can either define the entire dataset directly inside the script, or load it from a local file.
The data element has to be defined before the elements theme and layout.
rnartist {
svg {
path = "/media/"
}
ss {
bn {
value = "(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))"
}
}
data {
1 to 200.7
2 to 192.3
3 to 143.6
}
}rnartist {
svg {
path = "/media/"
}
ss {
bn {
value = "(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))"
}
}
data {
file = "/project/QuSHAPE_01_shape_mode_reactivities.txt"
}
}The structure of a local file describing a dataset is really simple. It's a text file where each line describes the absolute_position in the RNA and its linked experimental value. The two fields are separated with a space character:
1 30.2
2 56.8
10 2.0
127 18.7
The values linked to each residue can be used as a selection criteria to define the colors, line width and details level.
If you know Kotlin, you can embed Kotlin instructions to power your script.
rnartist {
svg {
path = "/media/"
}
ss {
bn {
value = "(((..(((..(((..(((((....)))))..)))..(((((....)))))..)))...)))"
}
}
data {
(1..secondaryStructures[0].length).forEach {
"${it}" to Math.random()
}
}
theme {
details {
value = 5
}
color {
type = "R"
value = "lightyellow"
to = "firebrick"
}
color {
type = "r"
value = "black"
to = "white"
}
hide {
type = "Y"
}
}
}If a dataset is linked to the RNA secondary structure, a colored gradient can be defined inside the color element. You need to use the parameters value and to. To restrict the distribution of values to be used, you can use the parameter data. You can select values lower than a value (lt), greater than a value (gt) or between two values (between).
rnartist {
ss {
bn {
seq = "GCGAAAAAUCGC"
value =
"((((....))))"
name = "dataset"
}
}
data {
1 to 200.7
2 to 192.3
3 to 143.6
4 to 34.8
5 to 4.5
6 to 234.9
7 to 12.3
8 to 56.8
9 to 59.8
10 to 140.5
11 to 0.2
12 to 345.8
}
theme {
details {
value = 4
}
color {
type = "N"
value = "lightyellow"
to = "firebrick"
data between 10.0..350.0
}
color {
type = "n"
value = "black"
to = "white"
data between 10.0..350.0
}
color {
type = "N"
value = "black"
data lt 10.0
}
color {
type = "n"
value = "white"
data lt 10.0
}
}
}On a Raspberry Pi, if you get this message when running the script plot_2ds.sh:
OpenJDK Server VM warning: No monotonic clock was available - timed services may be adversely affected if the time-of-day clock changes
RNArtistcore will hang on. This is not related to RNArtistCore, but you need to update the library libseccomp2 for your RPi. To do so, you can :
- get this file http://ftp.debian.org/debian/pool/main/libs/libseccomp/libseccomp2_2.5.1-1_armhf.deb
- type:
sudo dpkg -i libseccomp2_2.5.1-1_armhf.deb - and it should work...




























