Skip to content

nkvamaks/oligoshell_calc

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

40 Commits
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

About OligoShell Calculator:

OligoShell Calculator is a comprehensive web application designed for calculating various properties of natural (DNA, RNA), modified, therapeutic oligonucleotides, as well as phosphorodiamidate morpholino oligos (PMO), thiomorpholino oligos (TMO), morpholino oligos (MO), and different chimeras with available nucleic acids. Our tool offers advanced features that meet the needs of researchers and professionals in the fields of nucleic acid chemistry and molecular biology.

Key Features:

  • NEW! Calculate properties of phosphorodiamidate morpholino oligos (PMO), thiomorpholino oligos (TMO), morpholino oligos (MO), and various chimeric oligonucleotides.
  • Compose oligonucleotides with different backbones including phosphodiester, phosphorothioate, phosphorodithioate, mesyl phosphoramidate, and dimethylamino phosphoramidate.
  • Calculate melting temperatures of MGB-modified oligonucleotide probes, similar to Primer Express 3.0 software.
  • Determine melting temperatures of DNA oligonucleotides with DNA targets.
  • Compute extinction coefficients using nearest neighbors model.
  • Obtain monoisotopic and average molecular weights and charge states.
  • Generate molecular formulas for oligonucleotides.
  • Predict theoretical masses of fragments in MS/MS experiments.
  • Quantify oligonucleotides based on user input of measured absorbance at 260 nm and volume of the oligonucleotide solution.

Sequence Input Guidelines:

Sequences must be entered from 5' to 3'. You can choose whether your oligonucleotide is primarily DNA, RNA, or Therapeutic. For sequences containing phosphorothioate linkages, use an asterisk (*) as a separator.

  • DNA / RNA Input

    Use single-letter codes for standard nucleotides (A, C, G, T/U) and degenerate nucleotides (W, S, M, K, R, Y, B, D, H, V, N). These single-letter codes represent deoxy-nucleotides for DNA and ribo-nucleotides for RNA. For other nucleotides or modifications, use their designated multi-letter codes enclosed in square brackets, e.g., [+Cm], [FAM], or [GALNAC-PRO].

  • Therapeutic Input

    Enter each nucleotide, degenerate nucleotide, or modification using its specific designation. Separate each entity (nucleotide, modification, or phosphate backbone) with a space.

  • To facilitate input, use dropdown menus with modifications of nucleotides from the 'keyboard'.

Examples:

  • DNA: ACGTACGTGGCAGGCA
  • DNA: [VIC]CCGGCGCGNTTSCGTC[MGB-ECLIPSE]
  • RNA: [po]ACGUGGCUSGACUGVUUGAUNG
  • RNA: GUGCGAAGGGACGGUGCGGAGAGGAGAGCAC[GALNAC3-ALN]
  • Therapeutic: +A +Cm +G dT dA dC dG dT dG dG dC dA dG +G +Cm +A
  • Therapeutic: +Cm * +G * +T * dA * dA * dC * dC * dT * dG * dA * dC * dC * dG * +A * +G * +A
  • Therapeutic (PMO): morC # morC # morT # morC # morC # morG # morG # morT # morT # morC # morT

Available Nucleotides:

  • Deoxynucleotides: dA, dC, dG, dT, dU, dCm
  • Degenerate deoxynucleotides: dW, dS, dM, dK, dR, dY, dB, dD, dH, dV, dN
  • Ribonucleotides: rA, rC, rG, rU
  • Degenerate ribonucleotides: rW, rS, rM, rK, rR, rY, rB, rD, rH, rV, rN
  • 2'-OMe nucleotides: mA, mC, mG, mU
  • 2'-F nucleotides: fA, fC, fG, fU
  • 2'-MOE nucleotides: moeA, moeCm, moeG, moeT
  • LNA nucleotides: +A, +Cm, +G, +T
  • Constrained ethyl (cEt) nucleotides: cetA, cetC, cetG, cetU
  • Morpholino nucleotides: morA, morC, morG, morT
  • GalNAc-modified amino-diethoxymethoxy (adem) nucleotides: ademA, ademC, ademG
  • > * Cm stands for 5-methylcytosine and T for 5-methyluracil

TOOLS:

New Tool: siRNA Scan & Score

siRNA Scan & Score is a web-based tool for designing and evaluating siRNA candidates based on sequence input. It identifies all possible 19- and 21-mer siRNAs from a given mRNA target and computes multiple scoring metrics including predicted on-target efficacy and off-target potential using independently implemented or published algorithms. The tool provides ranked output, interactive filtering, and detailed scoring breakdowns to support researchers in selecting potent and specific siRNA sequences for experimental use.

TaqMan Finder

This tool simplifies the process of finding matching primers and probes for TaqMan assays within your specified target sequence. By providing the exact (single isotope) masses of both primers and the probe, chemical modifications of the probe, length of the amplicon, and the reference sequence (RefSeq), you can easily identify compatible components of your assay.

Experience full functionality of the OligoShell Calculator online at www.oligoshell.com

About

Oligonucleotide Calculator

Topics

Resources

License

Stars

7 stars

Watchers

1 watching

Forks

Contributors